Seracare Pik3Ca

Lab Reagents

Human IgG antibody Laboratories manufactures the seracare pik3ca reagents distributed by Genprice. The Seracare Pik3Ca reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact SeraCare Inc.. Other Seracare products are available in stock. Specificity: Seracare Category: Pik3Ca

Serum / Plasma information

PIK3CA siRNA

20-abx928613
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PIK3CA Antibody

ABD2625 100 ug
EUR 438

PIK3CA Antibody

ABD6068 100 ug
EUR 438

PIK3CA Rabbit pAb

A12484-100ul 100 ul
EUR 308

PIK3CA Rabbit pAb

A12484-200ul 200 ul
EUR 459

PIK3CA Rabbit pAb

A12484-20ul 20 ul
EUR 183

PIK3CA Rabbit pAb

A12484-50ul 50 ul
EUR 223

PIK3CA Blocking Peptide

DF2625-BP 1mg
EUR 195

PIK3CA Blocking Peptide

DF6068-BP 1mg
EUR 195

PIK3CA Rabbit pAb

A0265-100ul 100 ul
EUR 308

PIK3CA Rabbit pAb

A0265-200ul 200 ul
EUR 459

PIK3CA Rabbit pAb

A0265-20ul 20 ul
EUR 183

PIK3CA Rabbit pAb

A0265-50ul 50 ul
EUR 223

PIK3CA Blocking Peptide

AF4669-BP 1mg
EUR 195

PIK3CA Conjugated Antibody

C38118 100ul
EUR 397

PIK3CA Blocking Peptide

BF0462-BP 1mg
EUR 195

PIK3CA cloning plasmid

CSB-CL017998HU-10ug 10ug
EUR 1146
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 3207
  • Sequence: atgcctccacgaccatcatcaggtgaactgtggggcatccacttgatgcccccaagaatcctagtagaatgtttactaccaaatggaatgatagtgactttagaatgcctccgtgaggctacattaataaccataaagcatgaactatttaaagaagcaagaaaataccccctcc
  • Show more
Description: A cloning plasmid for the PIK3CA gene.