Efemp1

Lab Reagents

Human IgG antibody Laboratories manufactures the efemp1 reagents distributed by Genprice. The Efemp1 reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact . Other Efemp1 products are available in stock. Specificity: Efemp1 Category:

Chemicals information

EFEMP1 Antibody

1-CSB-PA008212
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against EFEMP1. Recognizes EFEMP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000

EFEMP1 siRNA

20-abx915021
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EFEMP1 siRNA

20-abx915022
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

EFEMP1 Antibody

ABD4032 100 ug
EUR 438

anti-EFEMP1

YF-PA11726 50 ug
EUR 363
Description: Mouse polyclonal to EFEMP1

EFEMP1 Blocking Peptide

33R-3444 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EFEMP1 antibody, catalog no. 70R-5349

EFEMP1 Blocking Peptide

33R-4746 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EFEMP1 antibody, catalog no. 70R-5350

EFEMP1 Blocking Peptide

33R-6674 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EFEMP1 antibody, catalog no. 70R-2375

EFEMP1 Blocking Peptide

DF4032-BP 1mg
EUR 195

EFEMP1 Antibody (HRP)

20-abx314107
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

EFEMP1 Antibody (FITC)

20-abx314108
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

EFEMP1 Antibody (Biotin)

20-abx314109
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

EFEMP1 cloning plasmid

CSB-CL007450HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1482
  • Sequence: atgttgaaagcccttttcctaactatgctgactctggcgctggtcaagtcacaggacaccgaagaaaccatcacgtacacgcaatgcactgacggatatgagtgggatcctgtgagacagcaatgcaaagatattgatgaatgtgacattgtcccagacgcttgtaaaggtggaa
  • Show more
Description: A cloning plasmid for the EFEMP1 gene.

Anti-EFEMP1 Antibody

STJ500846 100 µg
EUR 476

EFEMP1 Antibody, HRP conjugated

1-CSB-PA007450LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EFEMP1. Recognizes EFEMP1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

EFEMP1 Antibody, FITC conjugated

1-CSB-PA007450LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EFEMP1. Recognizes EFEMP1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

EFEMP1 Antibody, Biotin conjugated

1-CSB-PA007450LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EFEMP1. Recognizes EFEMP1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA