Efemp1

Lab Reagents

Human IgG antibody Laboratories manufactures the efemp1 reagents distributed by Genprice. The Efemp1 reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact . Other Efemp1 products are available in stock. Specificity: Efemp1 Category:

Chemicals information

EFEMP1 Antibody
1-CSB-PA007450LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EFEMP1. Recognizes EFEMP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

EFEMP1 Antibody
1-CSB-PA008212	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against EFEMP1. Recognizes EFEMP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000

EFEMP1 Antibody
CSB-PA274200-	Cusabio		EUR 335
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against EFEMP1. Recognizes EFEMP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

EFEMP1 Antibody
CSB-PA274200-100ul	Cusabio	100ul	EUR 316
Form: liquid Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific Show more
Description: A polyclonal antibody against EFEMP1. Recognizes EFEMP1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:3000

anti-EFEMP1
YF-PA11726	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to EFEMP1

EFEMP1 cloning plasmid
CSB-CL007450HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1482 Sequence: atgttgaaagcccttttcctaactatgctgactctggcgctggtcaagtcacaggacaccgaagaaaccatcacgtacacgcaatgcactgacggatatgagtgggatcctgtgagacagcaatgcaaagatattgatgaatgtgacattgtcccagacgcttgtaaaggtggaa Show more
Description: A cloning plasmid for the EFEMP1 gene.

EFEMP1 Antibody (HRP)
20-abx314107	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

EFEMP1 Antibody (FITC)
20-abx314108	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

EFEMP1 Antibody (Biotin)
20-abx314109	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

EFEMP1 Blocking Peptide
33R-3444	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EFEMP1 antibody, catalog no. 70R-5349

EFEMP1 Blocking Peptide
33R-4746	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EFEMP1 antibody, catalog no. 70R-5350

EFEMP1 Blocking Peptide
33R-6674	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EFEMP1 antibody, catalog no. 70R-2375

EFEMP1 Blocking Peptide
DF4032-BP	Affbiotech	1mg	EUR 195

Anti-EFEMP1 Antibody
STJ500846	St John's Laboratory	100 µg	EUR 476

Mouse EFEMP1 shRNA Plasmid
20-abx981016	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human EFEMP1 shRNA Plasmid
20-abx951537	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

EFEMP1 Antibody, HRP conjugated
1-CSB-PA007450LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EFEMP1. Recognizes EFEMP1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA