Efemp1

Lab Reagents

Human IgG antibody Laboratories manufactures the efemp1 reagents distributed by Genprice. The Efemp1 reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact . Other Efemp1 products are available in stock. Specificity: Efemp1 Category:

Chemicals information

EFEMP1 Antibody
1-CSB-PA008212	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against EFEMP1. Recognizes EFEMP1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000

EFEMP1 siRNA
20-abx915021	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

EFEMP1 siRNA
20-abx915022	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

EFEMP1 Antibody
ABD4032	Lifescience Market	100 ug	EUR 438

anti-EFEMP1
YF-PA11726	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to EFEMP1

EFEMP1 Blocking Peptide
33R-3444	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EFEMP1 antibody, catalog no. 70R-5349

EFEMP1 Blocking Peptide
33R-4746	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EFEMP1 antibody, catalog no. 70R-5350

EFEMP1 Blocking Peptide
33R-6674	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EFEMP1 antibody, catalog no. 70R-2375

EFEMP1 Blocking Peptide
DF4032-BP	Affbiotech	1mg	EUR 195

EFEMP1 Antibody (HRP)
20-abx314107	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

EFEMP1 Antibody (FITC)
20-abx314108	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

EFEMP1 Antibody (Biotin)
20-abx314109	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

EFEMP1 cloning plasmid
CSB-CL007450HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1482 Sequence: atgttgaaagcccttttcctaactatgctgactctggcgctggtcaagtcacaggacaccgaagaaaccatcacgtacacgcaatgcactgacggatatgagtgggatcctgtgagacagcaatgcaaagatattgatgaatgtgacattgtcccagacgcttgtaaaggtggaa Show more
Description: A cloning plasmid for the EFEMP1 gene.

Anti-EFEMP1 Antibody
STJ500846	St John's Laboratory	100 µg	EUR 476

EFEMP1 Antibody, HRP conjugated
1-CSB-PA007450LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EFEMP1. Recognizes EFEMP1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

EFEMP1 Antibody, FITC conjugated
1-CSB-PA007450LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EFEMP1. Recognizes EFEMP1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

EFEMP1 Antibody, Biotin conjugated
1-CSB-PA007450LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against EFEMP1. Recognizes EFEMP1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA